Primer Design

Primer design for pLEICS vectors is very simple:

  1. Decide which vector family you want to use (see below)
  2. Copy the appropriate 5' vector homology region for forward and reverse primers
  3. Design the insert homology region according to your desired insert 15-25 bp (longer if AT rich, shorter if GC rich) ensure 8bp at 3' end are unique if possible, and end (3') in a A or T.

An example of Vector family A primer design:
Key:

Your protein sequence

Homology tag

 
1.    Find which Family your vector is from the website.
2.    Family A homology sequence from PROTEX website:
 
          N-ter: GTATTTTCAGGGCGCC
          C-ter: GACGGAGCTCGAATTTCA


3.    Primer design:
               Met  Glu  Gly   Arg  Gly  Asn  Thr
5’ GTATTTTCAGGGCGCCATGGAGGGCCGTGGAAATACG------------
                               3’ TACCTCCCGGCACCTTTATGC------------
               Ala   Ser  Lys  Leu  Lys  Cys  Gly

-------GCTAGCAAGTTAAAATGTGGC 3’

-------CGATCGTTCAATTTTACTCCGACTTTAAGCTCGAGGCAG 5’

 
Forward primer:
5’ GTATTTTCAGGGCGCCATGGAGGGCCGTGGAAATACG 3'


Reverse primer: 
5’ GACGGAGCTCGAATTTCAGCCTCATTTTAACTTGCTAGC 3‘
 
*Remember to design 5’ to 3’ by reversing your DNA sequence, (in green.)
 
An example of Vector Family A Mutagenesis primer design:
Key:  Homology tag

  Your protein sequence

  Region of mutation

Forward 1→              Met   Asn  Val   Ser   Lys   Gly  Asp
5’ GTATTTTCAGGGCGCCATGAACGTGAGCAAGGGCGAT---------

                                   TACTTGCACTCGTTCCCGCTA---------

Forward 2→               Mutate to AAC

 

----CCACCTACGGCAAGCTGAcccTGAAGTTCATCTGCACCA----

----GGTGGATGCCGTTCGTCTgggACTTCAAGTAGACGTGGT----

    Mutate to TTG ← Reverse1

       Tyr   Val   Thr  Lys   Arg   Ala   Thr

------TACGTCACGAAGCGGGCGACA 3’

------ATGCAGTGCTTCGCCCGCTGTACTTTAAGCTCGAGGCAG 5’  ←Reverse2

Primers:

PCR 1(a)

Forward 1: 5’ GTATTTTCAGGGCGCCATGAACGTGAGCAAGGGCGAT 3’

Reverse 1: 5’ TGGTGCAGATGAACTTCAGTTTCAGCTTGCCGTAGGTGG 3’

 

PCR 1(b)

Forward 2: 5’ CCACCTACGGCAAGCTGAAACTCAGCTTGCCGTAGGTGG 3’
Reverse 2: 5’ GACGGAGCTCGAATTTCATGTCGCCCGCTTCGTGACGTA 3’
 
*Remember to design 5’ to 3’ by reversing your DNA sequence.
 
PCR 2: F1+R2 (using products from PCR 1 (a) + 1 (b) as a template to give whole DNA.
 

 

 

 

 

Family A homology sequence from PROTEX website

N-ter: GTATTTTCAGGGCGCC
C-ter: GACGGAGCTCGAATTTCA

Primer F1: 5' GTATTTTCAGGGCGCCATGAACGTGAGCAAGGGCGA

Primer R1: 5' GACGGAGCTCGAATTTCAGCGGGCGAAGCACTGCA3'

18nt..................Mutation..................18nt

Mutation F2: 5' CCACCTACGGCAAGCTGAAACTGAAGTTCATCTGCACCA 3'

Mutation R2: 5' TGGTGCAGATGAACTTCAGTTTCAGCTTGCCGTAGGTGG 3'

We will provide advice for customers to design vector based primers for the cloning using their vectors

Family A vectors homology region:

N-ter: GTATTTTCAGGGCGCC...
C-ter: GACGGAGCTCGAATTTCA...


Family A1 pLEICS-12 vector homology region without Tag (Cut with KpnI and EcoRI has a different N-ter primer):

                                                                                                 N-ter TATAGGGAGACCCAAGCTTGGTACC

Family B vectors homology region:

N-ter: AGGAGATATACATATG...
C-ter-His or GST tag: GAAGTACAGGTTCTC...
C-ter-no tag: GAAGTACAGGTTCTCTCA...

Family C vectors homology region:

N-ter: TACTTCCAATCCATG...
C-ter: TATCCACCTTTACTGTCA...

Family D vectors homology region (with TEV site):

N-ter: GTATTTTCAGGGCGCC ...
C-ter: GTCGACTGCAGAATTtca ...

Family E vectors homology region (without TEV site):

N-ter: TCCGGACTCAGATCT ...
C-ter: GTCGACTGCAGAATTtca ...

Family F vectors homology region:

N-ter: CGAAACGAGGAATTCTCGATG ...
C-ter: CAGGTTCTCACTAGT ...

Family G vectors homology region:

N-ter: GCTCGAGAATTCTTCG ...
C-ter: CAGGTTCTCACTAGT ...

Family H vectors homology region:

N-ter: TACGTAGAATTCTCGATG ...
C-ter: CAGGTTCTCACTAGT ...

Family I vectors homology region:

N-ter: TACGTAGAATTCTCG ...
C-ter: CAGGTTCTCACTAGT ...

Family J vectors homology region (with TEV site):

N-ter: GTATTTTCAGGGCGCC ...
C-ter: CAATGCCAATAGGATATCtca ...

Family K vectors homology region (without TEV site):

N-ter: TCCGGACTCAGATCT ...
C-ter: GTGGTGGTGGTGCTCGAGtca ...

pLEICS-12 vector homology region without His10-3xFLAG Tag (Cut with KpnI and EcoRI):

N-ter: TATAGGGAGACCCAAGCTTGGTACC...
C-ter: GACGGAGCTCGAATTTCA...

Family 29T vector homology region (with TEV site):

N-ter: TAGCGCTACCGGACTCAGATCTCGAGATG...
C-ter: CTGAAAATACAGGTTCTCGAG...

Family 29 vector homology region (without TEV site):

N-ter: CTACCGGACTCAGATCTCGAGATG...
C-ter: TACCGTCGACTGCATGAATTC...

Family 35 vector homology region:

N-ter: ATGGCCATGGAGGCCGAATTC...
C-ter: TCGACGGATCCCCGGGAATTC...

Family 36 vector homology region:

N-ter: GCCATGGAGGCCAGTGAATTC...
C-ter: ATGCCCACCCGGGTGGAATTC...

Family 37 vector homology region:

N-ter: CTACTCTAGAGCTAGCGAATTC...
C-ter: GGATCCGATTTAAATTCGAATTCtca...

Family 39C-Tag vector homology region:

N-ter: AGGGAGACCCAAGCTTGGTACCATG...
C-ter: TCGAGACGGAGCTCGAATTC

Family 39NC-Tag vector homology region:

N-ter: GTATTTTCAGGGCGCC...
C-ter: TCGAGACGGAGCTCGAATTC

Family 40C-Tag vector homology region:

N-ter: AGGGAGACCCAAGCTTGGTACCATG...
C-ter: ACGGTGTTGTCCTTCATCTCGAG

Family 40NC-Tag vector homology region:

N-ter: GTATTTTCAGGGCGCC...
C-ter: ACGGTGTTGTCCTTCATCTCGAG

Family 49 vector homology region:

N-ter: ACCCAAGCTTGGTACCATG...
C-ter: AAAATACAGGTTCTCGAG...

Family 69 vector homology region:

N-ter: TTCCAGGGGCCCCTGGGATCC...
C-ter: CTCGAGTCGACCCGGGAATTCtca...

Family 72 vector homology region:

N-ter: CATCATTTTGGCAAAGAATTCATG ...
C-ter: GGAGGGAGAGGGGCGGAATTCtca ...

Family 73 vector homology region:

N-ter: ACCTGTGGGTACCCGCTCGAGATG ...
C-ter: TATCGATACCGTCGACCTCGAGtca ...

Family 74 vectors homology region:

N-ter: TCTGCTACCACAGCCGCGGATCC ...
C-ter: TCCTTCACAAAGATCCTCTAGAtca...

Family 76 vector homology region:

N-ter: CATCATCAGACCACGCGGATTC ...
C-ter: TCCTTCACAAAGATCCTCTAGAtca ...

Family 77 vector homology region:

N-ter: CATCATTTTGGCAAAACC ...
C-ter: GACGGAGCTCGAATTtca ...

Family 79 vector homology region:

N-ter: TTCAGGCGGCCGCGGCTCGAGC ...
C-ter: TTCTCCTTTACTCATGGATCCtca ...

Family 80 vector homology region:

N-ter: TCCAAGTTTGGTCTAGAGCTAGCATG ...
C-ter: CCGCGGATCCGATTTAAATTCGAAtca ...

Family 81 vector homology region:

N-ter: CTGGAATTCCCGGGGATC ...
C-ter: CTGCAGGTCGACGGATCC ...

Family 82 vector homology region:

N-ter: GGTGGGATCGATTGGATC ...
C-ter: CTCGGTACCCGGGGATCC ...

Family 85 vector homology region:

N-ter: TATCGATAGGTACCGAGCTC ...
C-ter: ATCGCAGATCTCGAGCCCGGG ...

Family 89 vector homology region:

N-ter: ATTTCCGGTCATGGGATG ...
C-ter: GACGGAGCTCGAATTTCA ...

Family 90 vector homology region:

N-ter: AGGAGATATACATATG ...
C-ter: CAGTACCGATTTCGGATCC ...

Family 94 vector homology region:

N-ter: TAGCTAGTTAATTAAGGATCC ...
C-ter: CGTACCACCACACTGGGATCC ...

Family 95 vector homology region:

Forward Primer: GNNNNNNNNNNNNNNNNNNNNgttttagagctagaaatagca
Reverse Primer: nnnnnnnnnnnnnnnnnnnnCGGTGTTTCGTCCTTTCCACA
N: 20-nt guild sequence; n: Reverse complementary of N.

Family 98 vector homology region:

Forward Primer: GNNNNNNNNNNNNNNNNNNNNgttttagagctagaaatagca
Reverse Primer: nnnnnnnnnnnnnnnnnnnnCCTATAGTGAGTCGTATTA
N: 20-nt guild sequence; n: Reverse complementary of N.

Family 118 vector homology region:

Forward Primer: NNNNNNNNNNNNNNNNNNNNNNNNtttttttagagctagaaatagcaag
Reverse Primer: nnnnnnnnnnnnnnnnnnnnnnnnATCTACACTTAGTAGAAATTGGT
N: 24-nt guild sequence; n: Reverse complementary of N.

Family 131-A homology region (Tag: N-His10-3xFlag, C-EGFP/mCherry-APEX2/miniSOG):

N-ter: AGGGCGCGATATCTAAGCTAGC ...
C-ter: GCCCTTGCTCACCATGAATTC ...

Family 131-B homology region (Tag: N-His10-3xFlag, C-APEX2/miniSOG Tag):

N-ter: AGGGCGCGATATCTAAGCTAGC ...
C-ter: GTCGAGCCCGAGCCCTTGGCGCGCCC ...

Family 131-C homology region (Tag: C-EGFP/mCherry-APEX2/miniSOG Tag):

N-ter: TATAGGGAGACCCAAGCTTGGTACCATG ...

C-ter: GCCCTTGCTCACCATGAATTC ...

Family 131-D homology region (Tag: C-APEX2/miniSOG Tag):

N-ter: TATAGGGAGACCCAAGCTTGGTACCATG ...
C-ter: GTCGAGCCCGAGCCCTTGGCGCGCCC ...

Family 135 vector homology region:

N-ter: GTCGAGTTAATTTGTTAACATG ...
C-ter: TGGTTAGCAGAGGGTTAACTCA ...

Family 136 vector homology region:

N-ter: GTATTTTCAGGGCGCC ...
C-ter: GCCCTTGCTCACCATGAATTC ...

Family 136 vector homology region without His10-3xFLAG Tag (Cut with KpnI and EcoRI):

N-ter: TATAGGGAGACCCAAGCTTGGTACC...
C-ter: GCCCTTGCTCACCATGAATTC...

Family 144 vector homology region:

Forward Primer: GNNNNNNNNNNNNNNNNNNNNgttttagagctagaaatagca
Reverse Primer: nnnnnnnnnnnnnnnnnnnnCAATCGCTATGTCGACTCTAT

N: 20-nt guild sequence; n: Reverse complementary of N

Family 151 vector homology region:

N-ter: TTCACACAGGAAACAGAATTC ...
C-ter: TCCGCTAGTCCGAGGCCTCGAG ...

Example primer design